Frequently Asked Questions

MORE QUESTIONS? GET IN TOUCH.
General FAQ

What is CRISPR/Cas9?

The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Type II system is a prokaryotic immunity that has been adapted for genome engineering. It consists of two components: a specific guide RNA (gRNA) and a non-specific CRISPR-associated endonuclease protein from Streptococcus pyogenes (Cas9). Due to its adaptability across a wide range of species and its simplicity of use, CRISPR/Cas9 has quickly revolutionized genome engineering.

Think of CRISPR/Cas9 as a pair of molecular scissors guided by a GPS. The Cas9 endonuclease is directed to a specific sequence target by a gRNA that contains a user-defined sequence of approximately 17-20 nucleotides, known as a “target sequence”, “spacer” or CRISPR RNA (crRNA). The gRNA is a short, single-stranded RNA molecule made up of this 17-20 nucleotide target spacer and a scaffold region for Cas9 binding (known as a tracer RNA or tracrRNA) that also provides in vivo stability through its secondary structure. Assembled gRNAs are formed in vivo through the hybridization of crRNA and tracrRNA, but this can also be done in vitro through the simple annealing of two short RNA oligos that share common linker sequences, such as Synthego’s CRISPRevolution cr/tracrRNAs. Alternatively, a chimeric cr/tracrRNA molecule known as a single guide RNA (sgRNA), such as Synthego’s CRISPRevolution sgRNAs can be used.

Once directed to a target via duplexing with a gRNA, Cas9 initiates a DNA double-strand break in the target sequence. Base-pairing occurs between the spacer on the crRNA portion and the corresponding sequence on the target DNA, known as a “protospacer”. This only takes place if the protospacer is next to an additional requirement for target recognition called a protospacer adjacent motif (PAM), a short sequence containing the nucleotides (5′) NGG (3′). With these requirements met, two distinct functional domains within the Cas9 protein mediate cleavage of the target DNA to create a double-stranded break (DSB) within the protospacer. Once a DSB is made, cells can use their repair machinery to correct the break through either non-homologous end-joining (NHEJ) or homology-directed repair (HDR). NHEJ repair results in insertions and/or deletions, known as “indels” which disrupt the targeted locus. Alternatively, HDR repair can be initiated if a donor DNA template with homology to the targeted locus is supplied. This allows for precise replacement mutations to be made, including programming single-nucleotide polymorphisms (SNPs), replacing small to large sections of sequence, deleting sequences or entire genes and inserting genes or entire synthetic pathways.

A distinct advantage to utilizing CRISPR/Cas9 for genome engineering is that the specific sequence target for Cas9 can be changed by simply changing the 17-20 nucleotide spacer sequence in the crRNA portion of the gRNA. This can be as simple as ordering a unique Synthego CRISPRevolution crRNA or sgRNA for each site you wish to target in a genome.

How do I use CRISPR/Cas9?

There are only a few requirements for using CRISPR/Cas9:

  • Identification of a 17-20 nucleotide sequence immediately upstream of a (5′) NGG (3′) PAM site that is unique compared to the rest of the targeted genome
  • A functional gRNA
  • Cas9 endonuclease

Synthego can provide you with high-quality, target specific synthetic sgRNA or with crRNA that can be annealed in vitro to an optimized, universal tracrRNA to form a fully functional gRNA.

Synthetic RNA from Synthego can be duplexed in vitro to Cas9 nuclease (see FAQ below) prior to transformation/transfection into a cell. Alternatively, Cas9 can be expressed within the cell line you wish to engineer.

Several versions of S. pyogenes Cas9 endonuclease exist and the appropriate version should be chosen depending on the type of cell being engineered and the desired experimental outcome:

Cas9 – the wild-type version of the endonuclease that produces a DSB.

Cas9 NLS – contains the SV40 nuclear localization signal that tags the protein for transport into the cell nucleus. Beneficial when eukaryotic cells are being edited.

Cas9 nickases – contains a mutation (D10A or H840A in S. pyogenes Cas9) that inactivates one of the two DNA strand cutting domains in Cas9, resulting in a nick to the target sequence, instead of a DSB. Useful for forcing DSB repair to occur via HDR using donor DNA (instead of NHEJ), which can reduce the likelihood of off-target effects.

dCas9 – “dead” Cas9, contains two mutations (D10A and H840A in S. pyogenes Cas9) which inactivate the DNA strand cutting activity of the endonuclease. Useful for gene-silencing/knockdown experiments.

Why should I use synthetic RNA instead of in vitro transcribed RNA or plasmid expressed guide RNA?

Using Synthego synthetic RNA as your guide RNA for CRISPR offers many advantages over traditional guide RNA synthesis techniques:

Speed
Synthetic RNA can save you up to a week on your CRISPR experiments. Compared to plasmid-based RNA guides, there is no need to design, construct, sequence verify and purify plasmid DNA for every target/guide you want to test. And there’s no need to spend precious lab hours working with expensive IVT kits. Use your extra time to catch up on other experiments!

Accuracy
Have greater control and precision for your CRISPR genome editing by controlling the exact amount of RNA for your transfection or microinjection.

Quality
When forming ribonucleoprotein (RNP) complexes with Cas9, you will get the cleanest possible edits. After transfection and genome editing have occurred, Cas9 and exogenous RNA will degrade. The probability of off-target effects are greatly reduced without continuous expression of Cas9 and/or guide RNA.

Price
Synthetic RNA offers an unbeatable price point when compared to the cost (and labor) of preparing guide RNA through plasmid or IVT methods. Synthego can synthesize cr/tracrRNA and sgRNA at smaller scales than anyone else in the industry – meaning you only pay for what you need.

High Throughput Ready
Synthetic RNA offers the kind of scalability not feasible with other traditional guide RNA generation techniques. Whether you want to test one target per gene or a hundred, it’s as easy as ordering the RNA through our online portal. Synthetic RNA allows you to order libraries of thousands of guide RNAs to test – avoid huge amounts labor and cost involved in creating guides using plasmids or IVT for high throughput applications!

Easy to use
Once a target sequence has been selected it’s easy to order RNA oligos through our online portal – which makes it as simple to order RNA for a single target as it does for a hundred. Once you click order, just sit back, relax and wait for your lyophilized RNA to show up in a few days.

How is CRISPRevolution RNA quality control tested?

The quality of the RNA is measured using electrospray ionization mass spectroscopy (ESI-MS) and solid-phase liquid chromatography to confirm the length and purity. The quantity of the full-length RNA is measured using analytical UPLC and A260 UV spectroscopy readings.

Can CRISPRevolution RNA be shipped internationally? What is the cost?

Absolutely. While all Synthego CRISPRevolution synthetic RNA is made in our facility in California, we are happy to ship to anywhere in the world – for only $19 USD.

What tools are available to help me design my target sequence?

Several tools exist to help you select a suitable guide RNA for your target gene/sequence that are predicted to have minimal off-target effects in the genome. We recommend that you try several different guide RNAs for your target in order to ensure optimal Cas9 activity.

Cloud-based DNA software packages with guide RNA design tools

Desktop Genetics: https://www.deskgen.com (free to use)
Benchling: https://benchling.com (free to use)

DNA software packages with guide RNA design tools

Geneious (R8 and newer): http://www.geneious.com (free trial version)
ApE: A Plasmid Editor (version 2.0.49 and newer): http://biologylabs.utah.edu/jorgensen/wayned/ape (free to use)

Free online guide RNA design tools 

sgRNA Designer (The Broad Institute): http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design
CRISPR Design (MIT): http://crispr.mit.edu
CHOPCHOP (Harvard University): https://chopchop.rc.fas.harvard.edu
Off-Spotter (Thomas Jefferson University): https://cm.jefferson.edu/Off-Spotter

Where can I get Cas9 Nuclease?

Synthego offers high quality 2NLS Cas9 nuclease. You can get it right here.

I'm not using S.pyogenes Cas9, or maybe I want to design my own guide RNA. How can I order a guide for my nuclease?

Using Cpf1, C2c2, S.aureus Cas9 or a novel nuclease? Want to alter the secondary structure of your tracrRNA? No problem, Synthego has you covered.

Visit our Custom RNA page and check out our custom RNA ordering. For example, you can order a Cpf1 guide RNA (under 50nt) by selecting to order our “Custom crRNA” length (35-49nt). Want something a little bigger, or design your own tracrRNA sequence? Select to order our “Custom tracrRNA” length (50-75nt). Or, go big and select “Custom sgRNA” for RNA up to 100nt.

What chemical modifications does Synthego offer? What are the advantages?

For a chemically modified version of our CRISPRevolution products, we offer 2’-O-methyl analogs and 3’ phosphorothioate internucleotide linkages at the first three 5’ and 3’ terminal RNA residues in the following configuration:

sgRNA: 5′-U*A*A*UUUCACAGCUGCACAUA+Synthego Scaffold…U*U*U*-3′

OR

crRNA: 5′-U*A*A*UUUCACAGCUGCACAUA+Synthego Linker…U*G*G*-3′

+

tracrRNA: 5′-A*A*A*+Synthego Scaffold…U*U*U*-3′

*=modification

Chemically modified sequences can provide additional improvements in editing efficiency for particular cell types (e.g. Stem Cells, K562, Prokaryotic) and genomic targets that prove otherwise challenging to edit.

If you’re interested in a chemically modified option, select Modifications from the dropdown menu when inputting your target sequence on the order page. If you would like alternative configurations or modifiers, please contact us.

Can I order specialized RNA modifications or ultra-purified RNA?

For specialized RNA modifications or ultra-high purity RNA, please contact us.

Can you recommend transfection protocols?

Transfection may need to be optimized for the cell type you are working with, and the type of delivery system you are using (e.g., electroporation, micro-injection etc.). In addition, optimization may be required depending on if you are expressing Cas9 within your cells or duplexing Cas9 nuclease with your guide RNA (annealed crRNA+tracrRNA) in vitro. If using Cas9 nuclease, it is important to consider nuclear localization signals (NLS) if working with eukaryotic cell types.

Please visit synthego.com/resources for CRISPR protocols.

How does CRISPR differ from the RNAi technology?

While CRISPR can be used like RNAi to silence gene expression, a key difference is that the researcher can use CRISPR to permanently delete a gene (or multiple genes at once), unlike RNAi which provides only temporary silencing.

However, the fundamental difference between the two is that CRISPR enables not only gene silencing through deletion, but also gene (and non-coding genome) EDITING. In other words, researchers can for the first time easily edit any part of the genome quickly in a highly efficient manner. Previously, this sort of work could take a researcher weeks or months to accomplish; with CRISPR, it can be achieved in a matter of hours and days.

sgRNA FAQ

What is sgRNA?

sgRNA cas9 - final smallA single guide RNA (sgRNA) is a chimera of crRNA and tracrRNA that is typically 100 nucleotides in length and consists of three regions:

  • A user defined, 17-20nt base-pairing region for specific DNA binding
  • A 40nt Cas9 handle hairpin for Cas9 protein binding
  • A 40nt long transcription terminator derived from S. pyogenes, that contains hairpin structures that provide stability to the RNA molecule.

Synthego is the only synthetic RNA provider in the industry who can provide full length sgRNA (100-mer) for CRISPR at a practical scale and price point that is over a thousand dollars less than the competition.

What are some of the advantages of using sgRNA over crRNA:tracrRNA?

Synthego sgRNA offers several advantages over older, 2-part crRNA:tracrRNA guide RNAs when it comes to CRISPR genome editing:

  • No need to anneal crRNA and tracrRNA in vitro: Annealing crRNA:tracrRNA annealing isn’t 100% efficient. Using sgRNA to form RNPs with Cas9 means more active complexes for CRISPR inside your cells. It also saves you time!
  • Better in vivo stability: The advanced secondary structure of sgRNA provides greater protection against intracellular exonucleases, meaning more of your RNA will bind to their target sequences.
  • The cleanest way to do CRISPR/Cas9 genome editing: Because sgRNA eradicates the need to do annealing, no potentially cytotoxic buffers or chemicals are added to your cells.

How should I dissolve my sgRNA?

Before starting, please note that Synthego recommends that you dissolve and dilute Synthego RNA to concentrations based upon the labeled amount. The value printed on the tube represents the dry yield of full-length product present in the tube. Synthego combines data obtained via IP-HPLC-UV and IP-UPLC-ESI-MS to accurately quantitate the amount of target oligonucleotide present.

  1. Briefly centrifuge your tubes or plates containing sgRNA oligos to ensure that the dried RNA pellet is collected at the bottom of the tube/plate.
  2. Carefully dissolve the RNA in nuclease-free 1X TE (Tris-EDTA pH 8.0) buffer to an appropriate concentration. For example, add 20µl of nuclease-free 1X TE buffer to 2nmol of normalized RNA product for a final concentration of 100µM (100 pmol/µl). To verify concentration, analyze 1-2µl on a Nanodrop instrument for best accuracy.
  3. Dissolved RNA should be stored at -20 °C in a manual defrost or non-cycling freezer. Under these conditions, RNA will be stable for at least one year.

How can I form a Ribonucleoprotein (RNP) complex between my sgRNA and Cas9 nuclease?

  1. To form a ribonucleoprotein (RNP) complex between guideRNA (sgRNA) and Cas9 nuclease, a 1:1 ratio of Cas9:guideRNA is recommended. However, you may need to optimize this ratio for your experiment, depending on the delivery method of the RNP (e.g., electroporation, transfection, microinjection). As a guide, for most applications a ratio between 1:1 ratio (Cas9:guideRNA) and 1:3 ratio (Cas9:guideRNA) is optimal.
  2. To duplex, first dilute Cas9 nuclease in the provided nuclease buffer to a suitable working concentration, e.g., 10µM (10 pmol/µl).
  3. As an example, for each transfection/injection, mix 2µl (20 pmol) of sgRNA with 2µl (20 pmol) of Cas9 nuclease. Then add transfection/injection media (or nuclease-free water) to a final volume of 12.5µl.
  4. Incubate at room temperature for 5-10 minutes to allow duplexes to form. Keep RNP complexes on ice until ready to use.

Can I order a full custom sgRNA?

Absolutely. Visit our Custom RNA page and check out our custom RNA ordering – you can order a full custom sgRNA between 76-100nt.

cr/tracrRNA FAQ

How do I ensure proper crRNA target sequence orientation?

When ordering, enter the 17-20nt protospacer domain (your target sequence) directly into the order page as an RNA oligo sequence. Enter the sequence in a forward orientation so that the PAM site is downstream of your sequence, and do not include the PAM site. The ordering system will automatically add a 22-mer linker to your sequence, allowing you to anneal to our standard tracrRNA to form a functional guide RNA.

For example:

Target sequence in genome:        5’ … ATCCAGAGGCCGTTGCTGAACACGCCATCGGTATGA …     3’

17-20nt protospacer:                      5’                                  GCCGTTGCTGAACACGCCAT                                    3’

RNA oligo to order:                          5’                                  GCCGUUGCUGAACACGCCAU                                  3’

How should I dissolve my crRNA and tracrRNA?

Before starting, please note that Synthego recommends that you dissolve and dilute Synthego RNA to concentrations based upon the labeled amount. The value printed on the tube represents the dry yield of full-length product present in the tube. Synthego combines data obtained via IP-HPLC-UV and IP-UPLC-ESI-MS to accurately quantitate the amount of target oligonucleotide present.

  1. Briefly centrifuge your tubes or plates containing crRNA and/or tracrRNA oligos to ensure that the dried RNA pellet is collected at the bottom of the tube/plate.
  2. Carefully dissolve the RNA in nuclease-free 1X TE (Tris-EDTA pH 8.0) buffer to an appropriate concentration. For example, add 20µl of nuclease-free 1X TE buffer to 2nmol of normalized RNA product for a final concentration of 100µM (100 pmol/µl). To verify concentration, analyze 1-2µl on a Nanodrop instrument for best accuracy.
  3. Dissolved RNA should be stored at -20 °C in a manual defrost or non-cycling freezer. Under these conditions, RNA will be stable for at least one year.

How should I anneal my crRNA and tracrRNA to form a duplexed guide RNA?

  1. As described above, dissolve each RNA oligo (crRNA and tracrRNA) in nuclease-free 1X TE Buffer to a workable concentration, e.g. 100µM (see previous FAQ).
  2. Add equimolar concentrations of the crRNA and tracrRNA to a larger volume of Annealing Buffer (6mM HEPES, 60mM KCl) in a sterile microcentrifuge tube. As an example, add 10µl of each 100µM RNA oligo (total of 20µl) to 80µl of Annealing Buffer to make a total of 100µl of 10µM annealed guideRNA (10 pmol/µl).
  3. Heat to 78 °C on a heating block or thermocycler block for 10 minutes, then at 37 °C for 30 minutes.  
  4. Remove from heat and allow to cool slowly (approximately 15 minutes) to room temperature on the benchtop. Gradual ramping on a thermocycler block can also be used. Allowing the annealed RNAs to cool slowly will promote stable RNA secondary structure formation.

How can I form a Ribonucleoprotein (RNP) complex between my cr:tracrRNA and Cas9 nuclease?

  1. To form a ribonucleoprotein (RNP) complex between guideRNA (annealed crRNA:tracrRNA) and Cas9 nuclease, a 1:1 ratio of Cas9:guideRNA is recommended. However, you may need to optimize this ratio for your experiment, depending on the delivery method of the RNP (e.g., electroporation, transfection, microinjection). As a guide, for most applications a ratio between 1:1 ratio (Cas9:guideRNA) and 1:3 ratio (Cas9:guideRNA) is optimal.
  2. To duplex, first dilute Cas9 nuclease in the provided nuclease buffer to a suitable working concentration, e.g., 10µM (10 pmol/µl).
  3. As an example, for each transfection/injection, mix 2µl (20 pmol) of the previously annealed gRNA (crRNA:tracrRNA) with 2µl (20 pmol) of Cas9 nuclease. Then add transfection/injection media (or nuclease-free water) to a final volume of 12.5µl.
  4. Incubate at room temperature for 5-10 minutes to allow duplexes to form. Keep RNP complexes on ice until ready to use.

customer-logos1
customer-logos-2

Have a Question? We’d Love to Hear from You.

For general inquiries or questions, give us a call at 888-611-6883 or send us a message

GET IN TOUCH